TotalSeq™-D0063 anti-human CD45RA Antibody

Pricing & Availability
Clone
HI100 (See other available formats)
Regulatory Status
RUO
Workshop
IV N906
Other Names
GP180, L-CA, LCA, LY5, T200, PTPRC
Isotype
Mouse IgG2b, κ
Barcode Sequence
TCAATCCTTCCGCTT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
304175 10 µg £253
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD45RA is a 205-220 kD single chain type I glycoprotein. It is an exon 4 splice variant of the tyrosine phosphatase CD45. The CD45RA isoform is expressed on resting/naïve T cells, medullary thymocytes, B cells and monocytes. CD45RA enhances both T cell receptor and B cell receptor signaling. CD45 non-covalently associates with lymphocyte phosphatase-associated phosphoprotein (LPAP) on T and B lymphocytes. CD45 has been reported to be associated with several other cell surface antigens including CD1, CD2, CD3, and CD4. CD45 has also been reported to bind galectin-1. CD45 isoform expression can change in response to cytokines.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for relevant formats of this clone) include: inhibition of CD45 functions2, immunohistochemical staining of frozen tissue sections3 and formalin-fixed paraffin-embedded tissue sections4, and immunocytochemistry15,16.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
  2. Yamada T, et al. 2002. J. Biol. Chem. 277:28830. (WB, Block)
  3. Weninger W, et al. 2003 J. Immunol. 170:4638. (IHC-F)
  4. Imanguli MM, et al. 2009. Blood. 113:3620 (IHC-P)
  5. Roque S, et al. 2007. J. Immunol. 178:8028. (FC) PubMed
  6. Smeltz RB. 2007. J. Immunol. 178:4786. (FC) PubMed
  7. Palendira U, et al. 2008. Blood (FC) PubMed
  8. Kuttruff S, et al. 2009. Blood 113:358. (FC) PubMed
  9. Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed
  10. Alanio C, et al. 2010. Blood 115:3718. (FC) PubMed
  11. Iannello A, et al. 2010. J. Immunol. 184:114. (FC) PubMed
  12. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  13. Guereau-de-Arellan M, et al. 2011. Brain. 134:3578. PubMed
  14. Canque B, et al. 2000. Blood 96:3748. (ICC)
  15. Imanguli MM, et al. 2009. Blood 13:3620. (ICC)
  16. Stoeckius M, et al. 2017. Nat. Methods. 14:865. (PG)
  17. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
RRID
AB_2892356 (BioLegend Cat. No. 304175)

Antigen Details

Structure
Tyrosine phosphatases, type I transmembrane (exon 4 splicing of CD45 gene), 205-220 kD
Distribution

B cells, naïve T cells, monocytes

Function
Enhances TCR and BCR signaling
Ligand/Receptor
Galectin-1, CD2, CD3, CD4
Cell Type
B cells, Monocytes, T cells, Tregs
Biology Area
Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Thomas M. 1989. Annu. Rev. Immunol. 7:339.
2. Trowbridge I, et al. 1994. Annu. Rev. Immunol.12:85.

Gene ID
5788 View all products for this Gene ID
UniProt
View information about CD45RA on UniProt.org

Other Formats

View All CD45RA Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD45RA HI100 FC
Biotin anti-human CD45RA HI100 FC
FITC anti-human CD45RA HI100 FC
PE anti-human CD45RA HI100 FC
PE/Cyanine5 anti-human CD45RA HI100 FC
Purified anti-human CD45RA HI100 FC,CyTOF®,ICC,IHC-P,IHC-F,SB
Alexa Fluor® 488 anti-human CD45RA HI100 FC
Alexa Fluor® 647 anti-human CD45RA HI100 FC,IHC-P
Pacific Blue™ anti-human CD45RA HI100 FC
Alexa Fluor® 700 anti-human CD45RA HI100 FC
PerCP/Cyanine5.5 anti-human CD45RA HI100 FC
PE/Cyanine7 anti-human CD45RA HI100 FC
APC/Cyanine7 anti-human CD45RA HI100 FC
Brilliant Violet 421™ anti-human CD45RA HI100 FC,IHC-P
Brilliant Violet 570™ anti-human CD45RA HI100 FC
Brilliant Violet 605™ anti-human CD45RA HI100 FC
Brilliant Violet 650™ anti-human CD45RA HI100 FC
Brilliant Violet 711™ anti-human CD45RA HI100 FC
Brilliant Violet 785™ anti-human CD45RA HI100 FC
Brilliant Violet 510™ anti-human CD45RA HI100 FC
Purified anti-human CD45RA (Maxpar® Ready) HI100 FC,CyTOF®
PE/Dazzle™ 594 anti-human CD45RA HI100 FC
APC/Fire™ 750 anti-human CD45RA HI100 FC
PerCP anti-human CD45RA HI100 FC
FITC anti-human CD45RA HI100 FC
TotalSeq™-A0063 anti-human CD45RA HI100 PG
Alexa Fluor® 594 anti-human CD45RA HI100 IHC-P
TotalSeq™-B0063 anti-human CD45RA HI100 PG
TotalSeq™-C0063 anti-human CD45RA HI100 PG
Brilliant Violet 750™ anti-human CD45RA HI100 FC
Spark NIR™ 685 anti-human CD45RA HI100 FC
APC anti-human CD45RA HI100 FC
PE/Fire™ 640 anti-human CD45RA HI100 FC
PE/Fire™ 700 anti-human CD45RA Antibody HI100 FC
Spark YG™ 581 anti-human CD45RA HI100 FC
TotalSeq™-D0063 anti-human CD45RA HI100 PG
Spark Violet™ 423 anti-human CD45RA HI100 FC,IHC-P
GMP FITC anti-human CD45RA HI100 FC
PE/Cyanine7 anti-human CD45RA HI100 FC
PE/Dazzle™ 594 anti-human CD45RA HI100 FC
APC/Fire™ 750 anti-human CD45RA HI100 FC
Spark UV™ 387 anti-human CD45RA HI100 FC
GMP APC anti-human CD45RA HI100 FC
TotalSeq™-Bn0063 anti-human CD45RA HI100 SB
Spark Blue™ 550 anti-human CD45RA HI100 FC
GMP PE/Dazzle™ 594 anti-human CD45RA HI100 FC
GMP APC/Fire™ 750 anti-human CD45RA HI100 FC
Spark PLUS UV™ 395 anti-human CD45RA HI100 FC
Spark Red™ 718 anti-human CD45RA HI100 FC
Go To Top Version: 1    Revision Date: 06/29/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account