- Clone
- TS2/4 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V S160
- Other Names
- LFA-1α chain, Integrin αL subunit, αL Integrin, ITGAL
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TATATCCTTGTGAGC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
350621 | 10 µg | £253 |
CD11a is a 170-180 kD type I transmembrane glycoprotein also known as LFA-1α chain and integrin αL subunit. CD11a non-covalently associates with integrin β2 (CD18) to form LFA-1. It is expressed on all leukocytes, including B and T lymphocytes, monocytes, macrophages, neutrophils, basophils and eosinophils. It is absent on non-hematopoietic tissues and platelets. CD11a plays a central role in leukocyte cell-cell interactions and is important in lymphocyte costimulation. CD11a/CD18 binds to ICAM-1 (CD54), ICAM-2 (CD102), and ICAM-3 (CD50).
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- HLA-DR CTL line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for relevant formats) include: immunoprecipitation1, 2. Note: the antibody TS2/4 recognizes the ß-propeller domain of CD11a and only immunoprecipitates the CD11a/CD18 complex.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Huang C and Springer TA. 1997. P. Natl. Acad. Sci. USA 94:3162. (IP)
- Sanchez-Madrid F, et al. 1983. J. Exp. Med. 158:1785. (IP)
- Sanchez-Madrid F, et al. 1982. P. Natl. Acad. Sci. USA 79:7489. (FC)
- RRID
-
AB_2892426 (BioLegend Cat. No. 350621)
Antigen Details
- Structure
- Integrin, type I transmembrane glycoprotein, noncovalently linked with integrin β2 (CD18) forms LFA-1, 170-180 kD
- Distribution
-
Leukocytes
- Function
- Adhesion, costimulation
- Ligand/Receptor
- ICAM-1(CD54), ICAM-2(CD102), ICAM-3(CD50)
- Cell Type
- Leukocytes, Tregs
- Biology Area
- Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Lub M, et al. 1995. Immunol. Today 16:479.
2. Parsons J. 1996. Curr. Opin. Cell Biol. 8:146. - Gene ID
- 3683 View all products for this Gene ID
- UniProt
- View information about CD11a on UniProt.org
Related FAQs
Other Formats
View All CD11a Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD11a | TS2/4 | FC,IP |
FITC anti-human CD11a | TS2/4 | FC |
PE anti-human CD11a | TS2/4 | FC |
PerCP anti-human CD11a | TS2/4 | FC |
PE/Cyanine7 anti-human CD11a | TS2/4 | FC |
APC/Fire™ 750 anti-human CD11a | TS2/4 | FC |
PerCP/Cyanine5.5 anti-human CD11a | TS2/4 | FC |
TotalSeq™-A0185 anti-human CD11a | TS2/4 | PG |
TotalSeq™-C0185 anti-human CD11a | TS2/4 | PG |
TotalSeq™-B0185 anti-human CD11a | TS2/4 | PG |
TotalSeq™-D0185 anti-human CD11a | TS2/4 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD11a
Human peripheral blood lymphocytes stained with PE anti-huma... -
FITC anti-human CD11a
Human peripheral blood lymphocytes stained with FITC anti-hu... -
PE anti-human CD11a
Human peripheral blood lymphocytes stained with PE anti-huma... Pre-lysed human blood leukocytes were stained with PE anti-h... -
PerCP anti-human CD11a
Human peripheral blood lymphocytes stained with PerCP anti-h... -
PE/Cyanine7 anti-human CD11a
Human peripheral blood lymphocytes were stained with PE/Cyan... -
APC/Fire™ 750 anti-human CD11a
Human peripheral blood lymphocytes were stained with APC/Fir... -
PerCP/Cyanine5.5 anti-human CD11a
Human peripheral blood lymphocytes were stained with PerCP/C... -
TotalSeq™-A0185 anti-human CD11a
-
TotalSeq™-C0185 anti-human CD11a
-
TotalSeq™-B0185 anti-human CD11a
-
TotalSeq™-D0185 anti-human CD11a
Follow Us