- Clone
- BL-CD6 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- T12
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TGGCCTAGCATTCAA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
313907 | 10 µg | £253 |
CD6 is a 100-130 kD single chain transmembrane glycoprotein also known as T12. It is a member of the scavenger receptor superfamily found on T and B cell subsets, thymocytes, and acute lymphocytic leukemia cells (ALL). CD6, interacting with its ligand CD166 (also known as ALCAM), is involved in T cell development and activation, as well as thymocyte adhesion.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2894550 (BioLegend Cat. No. 313907)
Antigen Details
- Structure
- Scavenger receptor superfamily, single chain transmembrane glycoprotein, 100-130 kD
- Distribution
-
T cell and B cell subset, thymocytes
- Ligand/Receptor
- CD166 (ALCAM)
- Cell Type
- B cells, T cells, Thymocytes
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Aruffo A, et al. 1997. Immunol. Today 18:498.
- Gene ID
- 923 View all products for this Gene ID
- UniProt
- View information about CD6 on UniProt.org
Other Formats
View All CD6 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
FITC anti-human CD6 | BL-CD6 | FC |
PE anti-human CD6 | BL-CD6 | FC |
TotalSeq™-D1173 anti-human CD6 | BL-CD6 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-human CD6
Human peripheral blood lymphocytes stained with BL-CD6 FITC -
PE anti-human CD6
Human peripheral blood lymphocytes stained with BL-CD6 PE Pre-lysed human blood leukocytes were stained with CD6 (clon... -
TotalSeq™-D1173 anti-human CD6
Follow Us