- Clone
- 6/40c (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CEACAM8, CD67, CGM6, NCA-95
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AGCTGTAAGTTTCGG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
392919 | 10 µg | £253 |
CD66b is a 95-100 kD glycosylphosphatidylinositol (GPI)-linked protein also known as CD67, CGM6, and NCA-95. CD66b is a member of the immunoglobulin superfamily, carcinoembryonic antigen (CEA)-like subfamily. CD66b, expressed on granulocytes, has been reported to induce activation in neutrophils and to be involved in heterophilic adhesion with CD66c.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Recombinant soluble human CEACAM8-Fc produced in HEK293 cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Singer, et al. 2014. PLoS One. 9(4):e94106. PMID: 24743304
- Klaile, et al. 2013. Respir Res. 14:85. PMID 23941132
- RRID
-
AB_2922618 (BioLegend Cat. No. 392919)
Antigen Details
- Structure
- Ig superfamily, CEA antigen group, GPI-linked glycoprotein
- Distribution
-
Granulocytes
- Function
- Cell adhesion, neutrophil activation
- Ligand/Receptor
- CD66c
- Cell Type
- Granulocytes
- Biology Area
- Immunology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
- Kuijpers T, et al. 1993. J Immunol. 151:4934.
- Kuroki M, et al. 1992. J Leuk Biol. 52:551.
- Gene ID
- 1088 View all products for this Gene ID
- UniProt
- View information about CD66b on UniProt.org
Other Formats
View All CD66b Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD66b | 6/40c | FC,IHC-P,SB |
PE anti-human CD66b | 6/40c | FC |
TotalSeq™-A0166 anti-human CD66b | 6/40c | PG |
Alexa Fluor® 594 anti-human CD66b | 6/40c | IHC-P |
TotalSeq™-C0166 anti-human CD66b | 6/40c | PG |
Alexa Fluor® 647 anti-human CD66b | 6/40c | IHC-P,FC |
TotalSeq™-B0166 anti-human CD66b | 6/40c | PG |
PE/Fire™ 640 anti-human CD66b Antibody | 6/40c | FC |
Brilliant Violet 421™ anti-human CD66b Antibody | 6/40c | FC,IHC-P |
TotalSeq™-D0166 anti-human CD66b | 6/40c | PG |
TotalSeq™-Bn0166 anti-human CD66b | 6/40c | SB |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD66b
-
PE anti-human CD66b
-
TotalSeq™-A0166 anti-human CD66b
-
Alexa Fluor® 594 anti-human CD66b
-
TotalSeq™-C0166 anti-human CD66b
-
Alexa Fluor® 647 anti-human CD66b
-
TotalSeq™-B0166 anti-human CD66b
-
PE/Fire™ 640 anti-human CD66b Antibody
-
Brilliant Violet 421™ anti-human CD66b Antibody
-
TotalSeq™-D0166 anti-human CD66b
-
TotalSeq™-Bn0166 anti-human CD66b
Follow Us