IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0058 anti-human HLA-A,B,C Antibody

Pricing & Availability
Clone
W6/32 (See other available formats)
Regulatory Status
RUO
Other Names
Major Histocompatibility Class I, MHC class I
Isotype
Mouse IgG2a, κ
Barcode Sequence
TATGCGAGGCTTATC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
311455 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

MHC class I antigens associated with β2-microglobulin are expressed by all human nucleated cells. MHC class I molecules are involved in presentation of antigens to CD8+ T cells. They play an important role in cell-mediated immune responses and tumor surveillance.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Cat, Cow, Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone W6/32 recognizes residues in the N terminus of the human ß2-microglobulin molecule21.

Additional reported applications (for the relevant formats) include: immunoprecipitaton2, Western blotting (non-reducing)3, immunohistochemical staining of acetone-fixed frozen tissue sections4,5, blocking6,7, inhibition of NK cell-mediated lysis10, and activation8,9. Clone W6/32 has been reported not to be suitable for immunohistochemistry on paraffin sections17. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays. For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 311428) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin < 0.01 EU/µg).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Darrow TL, et al. 1989. J. Immunol. 142:3329.
  2. Stern P, et al. 1987. J. Immunol. 138:1088.
  3. Tran TM, et al. 2001. Immunogenetics 53:440.
  4. Barbatis C, et al. 1981. Gut 22:985.
  5. Ayyoub M, et al. 2004. Cancer Immunity 4:7.
  6. DeFelice M, et al. 1990. Cell. Immunol. 126:420.
  7. Fayen J, et al. 1998. Int. Immunol. 10:1347.
  8. Turco MC, et al. 1988. J. Immunol. 141:2275.
  9. Geppert TD, et al. 1989. J. Immunol. 142:3763.
  10. Wooden SL, et al. 2005. J. Immunol. 175:1383.
  11. Nagano M, et al. 2007. Blood 110:151.
  12. McLoughlin RM,et al.2008. J. Immunol. 181:1323. PubMed
  13. Takahara M, et al.2008. J. Leukoc. Biol. 83:742. PubMed
  14. Lunemann A, et al.2008. J. Immunol. 181:6170. PubMed
  15. Laing BJ, et al. 2010. J. Thorac Cardiovasc Surg. 139:1402. PubMed
  16. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  17. Vambutas A, et al. 2000. Clin. Diagn. Lab. Immun. 7:79.
  18. Coppieters KT, et al. 2012. J. Exp. Med. 209:51. (epitope)
  19. Crivello P, et al. 2013. Hum Immunol. 22:100. PubMed
  20. Jung Y, et al. 2015. Mol Cancer Res. 13:197. PubMed
  21. Shields MJ. Ribaudo RK. 1998. Tissue Antigens. 51(5):567-70. (epitope)
RRID
AB_2894581 (BioLegend Cat. No. 311455)

Antigen Details

Structure
Ig superfamily
Distribution

All nucleated cells

Function
Antigen presentation
Ligand/Receptor
CD3/TCR, CD8
Biology Area
Immunology, Innate Immunity
Molecular Family
MHC Antigens
Antigen References

1. Barclay AN, et al. Eds. 1993. The Leukocyte Antigen FactsBook. Academic Press Inc. San Diego.

Gene ID
3105 View all products for this Gene ID
UniProt
View information about HLA-A on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All HLA-A,B,C Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human HLA-A,B,C W6/32 FC
FITC anti-human HLA-A,B,C W6/32 FC
PE anti-human HLA-A,B,C W6/32 FC
PE/Cyanine5 anti-human HLA-A,B,C W6/32 FC
Purified anti-human HLA-A,B,C W6/32 FC,Activ,Block,IHC-F,IP,WB
Alexa Fluor® 488 anti-human HLA-A,B,C W6/32 FC
Alexa Fluor® 647 anti-human HLA-A,B,C W6/32 FC
Pacific Blue™ anti-human HLA-A,B,C W6/32 FC
PerCP anti-human HLA-A,B,C W6/32 FC
APC/Cyanine7 anti-human HLA-A,B,C W6/32 FC
PerCP/Cyanine5.5 anti-human HLA-A,B,C W6/32 FC
Ultra-LEAF™ Purified anti-human HLA-A,B,C W6/32 FC,Activ,Block,IHC-F,IP,WB
PE/Cyanine7 anti-human HLA-A,B,C W6/32 FC
Brilliant Violet 510™ anti-human HLA-A,B,C W6/32 FC
Alexa Fluor® 700 anti-human HLA-A,B,C W6/32 FC
PE/Dazzle™ 594 anti-human HLA-A,B,C W6/32 FC
Biotin anti-human HLA-A,B,C W6/32 FC
Brilliant Violet 605™ anti-human HLA-A,B,C W6/32 FC
APC/Fire™ 750 anti-human HLA-A,B,C W6/32 FC
TotalSeq™-A0058 anti-human HLA-A,B,C W6/32 PG
TotalSeq™-C0058 anti-human HLA-A,B,C W6/32 PG
TotalSeq™-B0058 anti-human HLA-A,B,C W6/32 PG
Spark NIR™ 685 anti-human HLA-A,B,C W6/32 FC
TotalSeq™-D0058 anti-human HLA-A,B,C W6/32 PG
GMP Ultra-LEAF™ Purified anti-human HLA-A,B,C SF W6/32 FC
GMP Ultra-LEAF™ Biotin anti-human HLA-A,B,C SF W6/32 FC
Spark UV™ 387 anti-human HLA-A,B,C W6/32 FC
Spark Red™ 718 anti-human HLA-A,B,C (Flexi-Fluor™) W6/32 FC
Spark Blue™ 574 anti-human HLA-A,B,C (Flexi-Fluor™) W6/32 FC
Spark Blue™ 550 anti-human HLA-A,B,C (Flexi-Fluor™) W6/32 FC
Go To Top Version: 1    Revision Date: 07/21/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account