- Clone
- RCR-401 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Endothelial protein C receptor, protein C receptor, PROCR, activated protein C receptor, APC receptor
- Isotype
- Rat IgG1, κ
- Barcode Sequence
- GTTTCCTTGACCAAG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
351913 | 10 µg | $369 |
Endothelial protein C receptor (EPCR), also known as CD201, is a 46 kD N-glycosylated type I transmembrane protein primarily expressed on the endothelial cells of arteries and veins in heart and lung. It is also expressed at high levels on a subset of hematopoietic stem cells and a subset of dendritic cells. CD201 functions as a primary receptor for protein C activation, which results in inhibition of both intrinsic and extrinsic coagulation pathways. It also plays an important role in many pathophysiologic processes, such as inflammation responses to infection, trauma, hematopoiesis, and autoimmune response. Deletion of the CD201 gene in knock-out mice leads to embryonic lethality before embryonic day 10, indicating that CD201 expression is critical for embryo development. In humans, mutations of CD201 have been associated with venous thromboembolism and myocardial infarction as well as with late fetal loss during pregnancy.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2941531 (BioLegend Cat. No. 351913)
Antigen Details
- Structure
- 46 kD of N-glycosylated type I transmembrane protein
- Distribution
-
Endothelial cells, subset of hematopoietic stem cells, subset of dendritic cells
- Function
- Inhibits blood coagulation, inflammation, and hematopoiesis
- Interaction
- Activated receptor1 (Par-1)
- Ligand/Receptor
- Protease C
- Cell Type
- Dendritic cells, Endothelial cells, Hematopoietic stem and progenitors
- Biology Area
- Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Kerschen E, et al. 2010. J. Clin. Invest. 120:3167.
2. Iwasaki H, et al. 2010. Blood 116:544.
3. Balazs AB, et al. 2006. Blood 107:2317. - Gene ID
- 10544 View all products for this Gene ID
- UniProt
- View information about CD201 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD201 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE anti-human CD201 (EPCR) | RCR-401 | FC |
Purified anti-human CD201 (EPCR) | RCR-401 | FC |
APC anti-human CD201 (EPCR) | RCR-401 | FC |
TotalSeq™-A0069 anti-human CD201 (EPCR) | RCR-401 | PG |
TotalSeq™-C0069 anti-human CD201 (EPCR) | RCR-401 | PG |
TotalSeq™-B0069 anti-human CD201 (EPCR) | RCR-401 | PG |
TotalSeq™-D0069 anti-human CD201 (EPCR) | RCR-401 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human CD201 (EPCR)
HUVEC cells were stained with CD201 (clone RCR-401) PE (fill... -
Purified anti-human CD201 (EPCR)
HUVEC cells were stained with CD201 (clone RCR-401) PE (fill... -
APC anti-human CD201 (EPCR)
HUVEC cells were stained with CD201 (clone RCR-401) APC (fil... -
TotalSeq™-A0069 anti-human CD201 (EPCR)
-
TotalSeq™-C0069 anti-human CD201 (EPCR)
-
TotalSeq™-B0069 anti-human CD201 (EPCR)
-
TotalSeq™-D0069 anti-human CD201 (EPCR)
Follow Us