- Clone
- M5E2 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- III 329
- Other Names
- LPS receptor
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- TCTCAGACCTCCGTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
301865 | 10 µg | $369 |
CD14 is a 53-55 kD glycosylphosphatidylinositol (GPI)-linked membrane glycoprotein also known as LPS receptor. CD14 is expressed at high levels on monocytes and macrophages, and at lower levels on granulocytes. Some dendritic cell populations such as interfollicular dendritic cells, reticular dendritic cells, and Langerhans cells have also been reported to express CD14. As a high-affinity receptor for LPS, CD14 is involved in the clearance of gram-negative pathogens, and in the upregulation of adhesion molecules and expression of cytokines in monocytes and neutrophils.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- African Green, Capuchin Monkey, Cow, Chimpanzee, Common Marmoset, Cotton-topped Tamarin, Dog, Pigtailed Macaque, Squirrel Monkey
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Full-length human CD14 protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The M5E2 antibody inhibits monocyte activation and cytokine production induced by LPS. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections, blocking of LPS stimulation4, and immunofluorescence microscopy5. Clone M5E2 is not recommended for immunohistochemical staining of formalin-fixed paraffin-embedded sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 301861 and 301862).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- McMichael A, et al. 1987. Leucocyte Typing III. Oxford University Press. New York.
- Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York. (IHC-F)
- Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
- Power CP, et al. 2004. J. Immunol. 173:5229. (Block)
- Williams KC, et al. 2001. J. Exp. Med. 193:905.
- Iwamoto S, et al. 2007. J. Immunol. 179:1449. (FC) PubMed
- Santer DM, et al. 2010. J. Immunol. 485:4739. PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Zizzo G, et al. 2012. J. Immunol. 189:3508. PubMed
- Stoeckius M, et al. 2017. Nat. Methods. 14:865. (PG)
- Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
- RRID
-
AB_2892347 (BioLegend Cat. No. 301865)
Antigen Details
- Structure
- GPI-linked membrane glycoprotein, 53-55 kD
- Distribution
-
Monocytes, macrophages, granulocytes (low)
- Function
- LPS receptor, clearance of Gram-negative pathogens
- Ligand/Receptor
- LPS
- Cell Type
- Granulocytes, Macrophages, Monocytes, Neutrophils
- Biology Area
- Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
- Molecular Family
- CD Molecules
- Antigen References
-
1. Stocks S, et al. 1990. Biochem. J. 268:275.
2. Wright S, et al. 1990. Science 249:1434. - Gene ID
- 929 View all products for this Gene ID
- UniProt
- View information about CD14 on UniProt.org
Other Formats
View All CD14 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD14
Human peripheral blood monocytes stained with M5E2 APC -
FITC anti-human CD14
Human peripheral blood monocytes stained with M5E2 FITC -
PE anti-human CD14
Human peripheral blood monocytes stained with M5E2 PE -
Purified anti-human CD14
Human peripheral blood monocytes stained with M5E2 APC -
PE/Cyanine7 anti-human CD14
Human peripheral blood monocytes stained with M5E2 PE/Cyanin... -
Alexa Fluor® 488 anti-human CD14
Human peripheral blood monocytes stained with M5E2 Alexa Flu... -
Alexa Fluor® 647 anti-human CD14
Human peripheral blood monocytes stained with M5E2 Alexa Flu... -
Ultra-LEAF™ Purified anti-human CD14
Human peripheral blood monocytes were stained with Ultra-LEA... -
Pacific Blue™ anti-human CD14
Human peripheral blood monocytes stained with clone M5E2 Pac... -
APC/Cyanine7 anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
Alexa Fluor® 700 anti-human CD14
Human peripheral blood monocytes stained with M5E2 Alexa Flu... -
PerCP/Cyanine5.5 anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
Biotin anti-human CD14
Human peripheral blood monocytes stained with biotinylated M... -
Brilliant Violet 421™ anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
Brilliant Violet 570™ anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
Brilliant Violet 605™ anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
Brilliant Violet 650™ anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
Brilliant Violet 711™ anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
Brilliant Violet 785™ anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
Brilliant Violet 510™ anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
Purified anti-human CD14 (Maxpar® Ready)
Human PBMCs stained with 154Sm-anti-CD45 (HI30) and 160Gd-an... -
PerCP anti-human CD14
Human peripheral blood monocytes were stained with PerCP CD1... -
FITC anti-human CD14
Typical results from human peripheral blood monocytes staine... -
PE/Dazzle™ 594 anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
Pacific Blue™ anti-human CD14
Typical results from human peripheral blood monocytes staine... -
APC/Fire™ 750 anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
APC anti-human CD14
Typical results from human peripheral blood monocytes staine... -
TotalSeq™-A0081 anti-human CD14
-
TotalSeq™-B0081 anti-human CD14
-
TotalSeq™-C0081 anti-human CD14
-
PE anti-human CD14
Typical results from human peripheral blood monocytes staine... -
PE/Cyanine5 anti-human CD14
Human peripheral blood monocytes were stained with CD14 (clo... -
TotalSeq™-D0081 anti-human CD14
-
APC/Fire™ 750 anti-human CD14
Typical results from human peripheral blood monocytes staine... -
GMP FITC anti-human CD14
Typical results from human peripheral blood monocytes staine... -
PE/Cyanine7 anti-human CD14
Typical results from human peripheral blood monocytes staine... -
GMP APC anti-human CD14
Typical results from human peripheral blood monocytes staine... -
GMP PE anti-human CD14
Typical results from human peripheral blood monocytes staine... -
PE/Dazzle™ 594 anti-human CD14
Typical results from human peripheral blood monocytes staine... -
GMP Pacific Blue™ anti-human CD14
Typical results from human peripheral blood monocytes staine... -
GMP APC/Fire™ 750 anti-human CD14
Typical results from human peripheral blood monocytes staine... -
PerCP/Cyanine5.5 anti-human CD14
Figure Legend: Typical results from human peripheral blood m... -
Spark Violet™ 500 anti-human CD14
Human peripheral blood monocytes were stained with anti-huma... -
GMP PE/Dazzle™ 594 anti-human CD14
Typical results from human peripheral blood monocytes staine... -
APC/Fire™ 810 anti-human CD14
Human peripheral blood monocytes were stained with anti-huma... -
PE/Fire™ 700 anti-human CD14
Human peripheral blood monocytes were stained with anti-huma...
Follow Us