- Clone
- X54-5/7.1 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- FcRI
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AGCAATTAACGGGAG
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
139325 | 10 µg | $369.00 |
CD64 is a 72 kD single chain type I glycoprotein also known as FcγRI and FcRI. CD64 is a member of the immunoglobulin superfamily and is expressed on monocytes/macrophages, dendritic cells, and mast cells. The expression can be upregulated by IFN-γ stimulation. CD64 binds IgG immune complex. It plays a role in antigen capture, phagocytosis of IgG/antigen complexes, and antibody-dependent cellular cytotoxicity (ADCC).
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- BALB/c mouse FcγRI-human IgG Fc fusion protein.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The X54-5/7.1 antibody reacts with mouse strains carrying CD64a and b alleles but not CD64d. X54-5/7.1 recognizes a conformational determinant formed between domains 2 and 3. Additional reported application (for relevant formats) include: immunoprecipitation1, and spatial biology (IBEX)5,6. Clone X54-5/7.1 is not found to be useful for Western blots1.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Tan PS, et al. 2003. J. Immunol. 170:2549. (IP)
- Ingersoll MA, et al. 2010. Blood 115:e10. (FC)
- Ozeri E, et al. 2012. J. Immunol. 189:146. PubMed
- Richardson ML, et al. 2014. PLoS Negl Trop Dis. 8:2825. PubMed
- Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- Product Citations
-
- RRID
-
AB_2750367 (BioLegend Cat. No. 139325)
Antigen Details
- Structure
- Ig superfamily, type I glycoprotein, 72 kD
- Distribution
-
Monocytes, macrophages, mast cells, dendritic cells
- Function
- Phagocytosis, ADCC
- Ligand/Receptor
- IgG
- Cell Type
- Dendritic cells, Macrophages, Mast cells, Monocytes
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules, Fc Receptors
- Gene ID
- 14129 View all products for this Gene ID
- UniProt
- View information about CD64 on UniProt.org
Other Formats
View All CD64 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-mouse CD64 (FcγRI)
C57BL/6 bone marrow cells stained with CD11b FITC and purifi... C57BL/6 bone marrow cells stained with CD11b FITC and mouse ... -
PE anti-mouse CD64 (FcγRI)
C57BL/6 bone marrow cells stained with CD11b FITC and X54-5/... C57BL/6 bone marrow cells stained with CD11b FITC and mouse ... -
APC anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with CD11b PE a... -
PerCP/Cyanine5.5 anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with CD11b APC ... -
Brilliant Violet 421™ anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with CD11b APC ... -
Brilliant Violet 711™ anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with CD11b FITC... -
PE/Cyanine7 anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with CD11b APC ... -
FITC anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with CD11b (clo... -
Biotin anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with CD11b (clo... -
PE/Dazzle™ 594 anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with CD11b (clo... -
Alexa Fluor® 647 anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with CD11b (clo... Mice were injected subcutaneously with sheep red blood cells... -
Brilliant Violet 605™ anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with CD11b APC ... -
TotalSeq™-A0202 anti-mouse CD64 (FcγRI)
-
TotalSeq™-C0202 anti-mouse CD64 (FcγRI)
-
TotalSeq™-B0202 anti-mouse CD64 (FcγRI)
-
PE/Cyanine5 anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with anti-mouse... -
APC/Fire™ 750 anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow cells were stained with anti-mouse... -
Brilliant Violet 510™ anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow was stained with anti-mouse/human ... -
Brilliant Violet 650™ anti-mouse CD64 (FcγRI)
C57BL/6 mouse bone marrow was stained with anti- mouse/human...