TotalSeq™-A0835 anti-mouse CD314 (NKG2D) Antibody

Product Details

Verified Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Rat

Immunogen

Mouse NKG2D

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Application Notes

To reduce non-specific binding, preincubate cells with purified anti-mouse CD16/CD32, clone 93 (Cat No 101301/2) is recommended.

 

This product is for in vitro research use only. It is not to be used for commercial purposes. Use of this product to produce products for sale or for diagnostic therapeutic or drug discovery purposes is prohibited. In order to obtain a license to use this product for commercial purposes contact The Regents of the University of California.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)

1. Ogasawara K, et al. 2003. Immunity 18:41. (Block)
2. Ogasawara K, et al. 2004. Immunity 20:757. (Block)
3. Kong LY, et al. 2010. Clin. Cancer Res. 16:2550. PubMed

Product Citations

1. Lin YH 2023. Immunity. 56(1):207-223.e8. PubMed

RRID

AB_2814023 (BioLegend Cat. No. 130215)

Antigen Details

Structure

NKG2D is a lectin-like type II transmembrane protein. It serves as a stimulatory receptor to activate NK cells via the non-covalently associated DAP10 or DAP 12 daptor protein.

Distribution

NK, NKT cells

Ligand/Receptor

RAE, H60,

Cell Type

NK cells, NKT cells

Biology Area

Costimulatory Molecules, Immunology

Molecular Family

CD Molecules

Gene ID

27007 View all products for this Gene ID

UniProt

View information about CD314 on UniProt.org

Related Protocols

• TotalSeq™-A Antibodies and Cell Hashing with 10x Single Cell 3' Reagent Kit v3 3.1 Protocol

Other Formats