- Clone
- CX5 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CD314
- Isotype
- Rat IgG1, κ
- Barcode Sequence
- GAGGCTTATCATTTC
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
130215 | 10 µg | $369.00 |
This antibody has been reported to block binding of NKG2D to its ligands, RAE-1 and H60, and inhibition of NKG2D-dependent NK-cell cytotoxicity.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Mouse NKG2D
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
To reduce non-specific binding, preincubate cells with purified anti-mouse CD16/CD32, clone 93 (Cat No 101301/2) is recommended.
This product is for in vitro research use only. It is not to be used for commercial purposes. Use of this product to produce products for sale or for diagnostic therapeutic or drug discovery purposes is prohibited. In order to obtain a license to use this product for commercial purposes contact The Regents of the University of California.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Ogasawara K, et al. 2003. Immunity 18:41. (Block)
- Ogasawara K, et al. 2004. Immunity 20:757. (Block)
- Kong LY, et al. 2010. Clin. Cancer Res. 16:2550. PubMed
- Product Citations
-
- RRID
-
AB_2814023 (BioLegend Cat. No. 130215)
Antigen Details
- Structure
- NKG2D is a lectin-like type II transmembrane protein. It serves as a stimulatory receptor to activate NK cells via the non-covalently associated DAP10 or DAP 12 daptor protein.
- Distribution
-
NK, NKT cells
- Ligand/Receptor
- RAE, H60,
- Cell Type
- NK cells, NKT cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Gene ID
- 27007 View all products for this Gene ID
- UniProt
- View information about CD314 on UniProt.org
Other Formats
View All CD314 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-mouse CD314 (NKG2D) | CX5 | FC |
PE anti-mouse CD314 (NKG2D) | CX5 | FC |
APC anti-mouse CD314 (NKG2D) | CX5 | FC |
PE/Dazzle™ 594 anti-mouse CD314 (NKG2D) | CX5 | FC |
TotalSeq™-A0835 anti-mouse CD314 (NKG2D) | CX5 | PG |
Ultra-LEAF™ Purified anti-mouse CD314 (NKG2D) | CX5 | FC,Block |
TotalSeq™-C0835 anti-mouse CD314 (NKG2D) | CX5 | PG |
TotalSeq™-B0835 anti-mouse CD314 (NKG2D) | CX5 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-mouse CD314 (NKG2D)
-
PE anti-mouse CD314 (NKG2D)
C57BL/6 splenocytes stained with DX5 FITC and CX5 PE -
APC anti-mouse CD314 (NKG2D)
C57BL/6 splenocytes stained with DX5 PE and CX 5 APC -
PE/Dazzle™ 594 anti-mouse CD314 (NKG2D)
C57/BL6 mouse splenocytes were stained with TruStain fcX™ (c... -
TotalSeq™-A0835 anti-mouse CD314 (NKG2D)
-
Ultra-LEAF™ Purified anti-mouse CD314 (NKG2D)
-
TotalSeq™-C0835 anti-mouse CD314 (NKG2D)
-
TotalSeq™-B0835 anti-mouse CD314 (NKG2D)