- Clone
- 9C4 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Ep-CAM, tumor associated calcium signal transducer 1, epithelial cell surface antigen, epithelial glycoprotein 2, EGP2, adenocarcinoma associated antigen, TROP1
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- TTCCGAGCAAGTATC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
324253 | 10 µg | 287€ |
CD326 is also known as Ep-CAM, tumor associated calcium signal transducer 1, epithelial cell surface antigen, epithelial glycoprotein 2, EGP2, adenocarcinoma associated antigen, and TROP1. CD326 is a type I transmembrane protein containing six disulfide bridges and one THYRO domain. This cell surface glycosylated 40 kD protein is highly expressed in bone marrow, colon, lung, and most normal epithelial cells and is expressed on carcinomas of gastrointestinal origin. Recently, it has been reported that CD326 expression occurs during the early steps of erythrogenesis. CD326 functions as a homotypic calcium-independent cell adhesion molecule and is believed to be involved in carcinogenesis by its ability to induce genes involved in cellular metabolism and proliferation. CD326 antigen is an immunotherapeutic target for the treatment of human carcinomas.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- DU.4475 breast carcinoma
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the revelant formats) include: immunofluorescence, immunohistochemistry3, and spatial biology (IBEX)4,5.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Lammers R, et al. 2002. Exp. Hematol. 30:537.
- Schultz LD, et al. 2010. P. Natl. Acad. Sci. USA 107:13022. PubMed
- Human Protein Atlas http://www.proteinatlas.org/ENSG00000119888/antibody (IHC)
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2927878 (BioLegend Cat. No. 324253)
Antigen Details
- Structure
- Type I transmembrane protein, contains six disulfide bridges, one THYRO domain, approximate molecular weight 40 kD.
- Distribution
-
Highly expressed in bone marrow, colon, lung, and most normal epithelial cells. Also highly expressed on carcinomas of gastrointestinal origin. Expressed during early erythrogenesis.
- Function
- Homotypic calcium-independent cell adhesion. CD326 is believed to be involved in carcinogenesis by its ability to induce genes involved in cellular metabolism and proliferation.
- Modification
- Glycosylated.
- Cell Type
- Embryonic Stem Cells, Epithelial cells
- Biology Area
- Cell Biology, Immunology, Stem Cells
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Strnad J, et al. 1989. Cancer Res. 49:314.
2. Munz M, et al. 2004. Oncogene 23:5748.
3. Rao CG, et al. 2005. Int. J. Oncol. 27:49. - Gene ID
- 4072 View all products for this Gene ID
- UniProt
- View information about CD326 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD326 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 stained with purified 9... BT474 breast cancer cells were stained with anti-human CD326... -
FITC anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 stained with 9C4 FITC -
PE anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 was stained with CD326 ... -
APC anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 stained with 9C4 APC -
Alexa Fluor® 488 anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 stained with 9C4 Alexa ... Confocal image of human jejunum sample acquired using the IB... Confocal image of human jejunum sample acquired using the IB... -
Alexa Fluor® 647 anti-human CD326 (EpCAM)
Human colon carcinoma cell line (HT29) stainined with 9C4 Al... MCF7 breast cancer cell line was stained with 4 µg/mL anti-h... -
PerCP/Cyanine5.5 anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT-29 was stained with CD326... -
Biotin anti-human CD326 (EpCAM)
Human colon carcinoma cell line (HT29) stained with biotinyl... -
Pacific Blue™ anti-human CD326 (EpCAM)
Human colon carcinoma cell line (HT29) stained with 9C4 Paci... -
Brilliant Violet 421™ anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 was stained with 9C4 Br... -
PE/Cyanine7 anti-human CD326 (EpCAM)
HT-29 cells were stained with CD326 (EpCAM) PE/Cyanine7 (fil... -
Brilliant Violet 605™ anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 was stained with CD326 ... -
Brilliant Violet 650™ anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 was stained with CD326 ... -
Alexa Fluor® 594 anti-human CD326 (EpCAM)
Human paraffin-embedded placenta tissue slices were prepared... Human colorectal adenocarcinoma cell line HT-29 was fixed wi... Confocal image of human metastatic lymph node sample acquire... -
Purified anti-human CD326 (EpCAM) (Maxpar® Ready)
Human HT-29 colon carcinoma cells (top) and human Jurkat T c... -
PE/Dazzle™ 594 anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 was stained with CD326 ... -
APC/Fire™ 750 anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 was stained with CD326 ... -
Brilliant Violet 510™ anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 was stained with CD326 ... -
Brilliant Violet 785™ anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 was stained with CD326 ... -
Brilliant Violet 711™ anti-human CD326 (Ep-CAM)
Human colon carcinoma cell line HT29 was stained with CD326 ... -
TotalSeq™-A0123 anti-human CD326 (Ep-CAM)
-
APC/Cyanine7 anti-human CD326 (Ep-CAM)
Human colon carcinoma cell line HT29 was stained with CD326 ... -
Alexa Fluor® 700 anti-human CD326 (EpCAM)
Human colon carcinoma cell line HT29 was stained with CD326 ... -
TotalSeq™-C0123 anti-human CD326 (Ep-CAM)
-
TotalSeq™-B0123 anti-human CD326 (Ep-CAM)
-
PE/Cyanine5 anti-human CD326 (Ep-CAM)
Human colon carcinoma cell line, HT29 was stained with CD326... -
TotalSeq™-D0123 anti-human CD326 (Ep-CAM)
-
Spark UV™ 387 anti-human CD326 (Ep-CAM)
Human colon carcinoma cell line HT29 was stained with anti-h... -
Spark Red™ 718 anti-human CD326 (Ep-CAM) (Flexi-Fluor™)
Follow Us