- Clone
- 24-31 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CD40L, gp39, TRAP, T-BAM, TNFSF5
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GCTAGATAGATGCAA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
310853 | 10 µg | 369 CHF |
CD154 (CD40 ligand) is also known as CD40L, gp39, TRAP and T-BAM. CD40 ligand is a 32-39 kD type II transmembrane glycoprotein. It is a member of the TNF superfamily and is expressed on activated T cells. It has been reported to be important for B cell costimulation following binding of its receptor, CD40. Additionally, binding of CD40L to CD40 on B cells promotes the secretion of immunoglobulin and Ig isotype switching. CD40L is also involved in the regulation of cytokine production by T cells.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunofluorescence microscopy1,3 and blocking of T cell-dependent B cell differentiation1,2,4,5. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 310812). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 310828) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Brams P, et al. 2001. Int. Immunopharmacol. 1:277. (Block, IF)
- Rushworth SA, et al. 2002. Transplantation 73:635. (Block)
- Berner B, et al. 2000. Ann. Rheum. Dis. 59:190. (IF)
- Nordström T, et al. 2006. J. Leukocyte Biol. 79:319. (Block)
- Zhang AL, et al.2007. Blood doi:10.1182/blood-2007-02-076364. (Block) PubMed
- Kuchen S, et al. 2007. J. Immunol. 179:5886.
- Matus-Nicodermos R, et al. 2011. J. Immunol. 186:2164. PubMed
- Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
- RRID
-
AB_2894564 (BioLegend Cat. No. 310853)
Antigen Details
- Structure
- TNF superfamily, type II transmembrane glycoprotein, cleaved as soluble CD40L, 32-39 kD
- Distribution
-
Activated T cells
- Function
- B cell costimulation
- Ligand/Receptor
- CD40
- Cell Type
- T cells, Tregs
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Najafian N, et al. 2003. Expert Opin. Biol. Ther. 3:227.
2. Racke M, et al. 2002. Expert Opin. Ther. Targets. 6:275.
3. Ford G, et al. 1999. J. Immunol. 162:4037. - Gene ID
- 959 View all products for this Gene ID
- UniProt
- View information about CD154 on UniProt.org
Related FAQs
Other Formats
View All CD154 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD154
PMA + ionomycin-stimulated human PBMCs (5 hours) stained wit... -
FITC anti-human CD154
TPA+ ionomycin-stimulated human PBMCs (6 hours) stained with... -
PE anti-human CD154
PMA+ionomycin-stimulated human PBMCs (6 hours) stained with ... -
PE/Cyanine5 anti-human CD154
TPA+ ionomycin-stimulated human PBMCs (6 hours) stained with... -
APC anti-human CD154
TPA+ ionomycin-stimulated human PBMCs (5 hours) stained with... -
Biotin anti-human CD154
TPA+ ionomycin-stimulated human PBMCs (5 hours) stained with... -
Alexa Fluor® 488 anti-human CD154
TPA+ ionomycin-stimulated human PBMCs (5 hours) stained with... -
Alexa Fluor® 647 anti-human CD154
TPA+ ionomycin-stimulated human PBMCs (5 hours) stained with... -
Pacific Blue™ anti-human CD154
PMA+ionomycin-stimulated human PBMCs (6 hours) stained with ... -
Brilliant Violet 785™ anti-human CD154
PMA + ionomycin-stimulated (6 hours) human peripheral blood ... -
APC/Cyanine7 anti-human CD154
TPA+ ionomycin-stimulated human PBMCs (5 hours) stained with... -
Brilliant Violet 421™ anti-human CD154
PMA+ionomycin-stimulated human peripheral blood lymphocytes ... -
Brilliant Violet 605™ anti-human CD154
6-hour PMA+ionomycin-stimulated human peripheral blood lymph... -
Ultra-LEAF™ Purified anti-human CD154
PMA+ionomycin-stimulated human PBMCs (6 hours) stained with ... -
Brilliant Violet 510™ anti-human CD154
PMA+ionomycin-stimulated (6 hours) human peripheral blood ly... -
PE/Cyanine7 anti-human CD154
PMA+ionomycin-stimulated (6 hours) human peripheral blood ly... -
PerCP/Cyanine5.5 anti-human CD154
PMA+ ionomycin-stimulated (6 hours) human peripheral blood l... -
Brilliant Violet 711™ anti-human CD154
PMA+ionomycin-stimulated (6 hours) human peripheral blood ly... -
Purified anti-human CD154 (Maxpar® Ready)
Human PBMCs were incubated for 6 hours in media alone (top) ... -
PE/Dazzle™ 594 anti-human CD154
PMA+ionomycin (six hours) stimulated human peripheral blood ... -
TotalSeq™-A0032 anti-human CD154
-
Alexa Fluor® 700 anti-human CD154
PMA+ionomycin-stimulated (6 hours) human peripheral blood ly... -
APC/Fire™ 750 anti-human CD154
PMA+ionomycin-stimulated (6 hours) human peripheral blood ly... -
TotalSeq™-C0032 anti-human CD154
-
TotalSeq™-B0032 anti-human CD154
-
TotalSeq™-D0032 anti-human CD154
-
PE/Fire™ 640 anti-human CD154
Human peripheral blood lymphocytes were stimulated with PMA+... -
PE/Fire™ 810 anti-human CD154
Human peripheral blood lymphocytes were stimulated with PMA+... -
PerCP/Fire™ 780 anti-human CD154
Human peripheral blood lymphocytes were stimulated with PMA+... -
PE/Fire™ 700 anti-human CD154
Human peripheral blood lymphocytes were stimulated with Cell... -
Spark Red™ 718 anti-human CD154 (Flexi-Fluor™)
Follow Us