- Clone
- 5.1H11 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Leu-19, NKH1, NCAM-1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TCCTTTCCTGATAGG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
362567 | 10 µg | 369 CHF |
CD56 is a single transmembrane glycoprotein also known as NCAM (neural cell adhesion molecule), Leu-19, or NKH1. It is a member of the Ig superfamily. The 140 kD isoform is expressed on NK and NKT cells. CD56 is also expressed in the brain (cerebellum and cortex) and at neuromuscular junctions. Certain large granular lymphocyte (LGL) leukemias, small-cell lung carcinomas, neuronal derived tumors, myelomas, and myeloid leukemias also express CD56. CD56 plays a role in homophilic and heterophilic adhesion via binding to itself or heparan sulfate.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human myotube cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Walsh FS, et al. 1981. Nature 289:60. (FC)
- Pavlath GK, et al. 1986. J. Cell Biol. 102:124. (FC)
- Pavlath GK, et al. 1989. Nature 337:570. (FC)
- Pulido R, et al. 1988. J. Immunol. 140:3851. (FC)
- RRID
-
AB_2904383 (BioLegend Cat. No. 362567)
Antigen Details
- Structure
- Ig superfamily, single transmembrane or GPI-anchored glycoprotein
- Distribution
-
NK cells, T subset, neural tissue, some LGL and myeloid leukemias
- Function
- Adhesion
- Ligand/Receptor
- Heparan sulfate
- Antigen References
-
1. Lanier L, et al. 1991. J. Immunol. 146:4421
2. Hemperly J, et al. 1990. J. Mol. Neurosci. 2:71
3. Cremer H, et al. 1994. Nature 367:455. - Gene ID
- 4684 View all products for this Gene ID
- UniProt
- View information about CD56 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD56 (NCAM) Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD56 (NCAM)
Human peripheral blood lymphocytes stained with Purified CD5... -
APC anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
PerCP/Cyanine5.5 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD16 AP... -
PE anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
PE/Cyanine7 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
APC/Cyanine7 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes stained with CD16 FITC an... -
PE/Cyanine5 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes stained with CD56 (clone ... -
Alexa Fluor® 647 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes stained with CD56 (clone ... -
Alexa Fluor® 488 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
Pacific Blue™ anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
Alexa Fluor® 700 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
PerCP anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
Brilliant Violet 650™ anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
Brilliant Violet 510™ anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
Brilliant Violet 421™ anti-human CD56 (NCAM)
Human peripheral blood lymphocytes stained with CD56 (clone ... -
Biotin anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with biotiny... -
Brilliant Violet 605™ anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (C... -
Brilliant Violet 570™ anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
Brilliant Violet 711™ anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
PE/Dazzle™ 594 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
FITC anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
Brilliant Violet 785™ anti-human CD56 (NCAM)
Human peripheral blood lymphocytes stained with CD56 (clone ... -
Ultra-LEAF™ Purified anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD56 (c... -
APC/Fire™ 750 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD16 PE... -
PE anti-human CD56 (NCAM)
Typical results from human peripheral blood lymphocytes sta... -
APC anti-human CD56 (NCAM)
Typical results from human peripheral blood lymphocytes sta... -
Brilliant Violet 750™ anti-human CD56 (NCAM)
Human peripheral blood lymphocytes stained with CD56 (clone ... -
TotalSeq™-A0047 anti-human CD56 (NCAM)
-
TotalSeq™-C0047 anti-human CD56 (NCAM)
-
TotalSeq™-B0047 anti-human CD56 (NCAM)
-
Spark NIR™ 685 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with CD16 (c... -
KIRAVIA Blue 520™ anti-human CD56 (NCAM)
Human Peripheral blood lymphocytes were stained with CD16 AP... -
GMP PE anti-human CD56 (NCAM)
Typical results from human peripheral blood lymphocytes stai... -
TotalSeq™-D0047 anti-human CD56 (NCAM)
-
GMP APC anti-human CD56 (NCAM)
Typical results from human peripheral blood lymphocytes stai... -
Spark YG™ 593 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with anti-hu... -
Cell-Vive™ GMP Ultra-LEAF™ Purified anti-human CD56 (NCAM) SF
Human peripheral blood lymphocytes were stained with Cell-Vi... -
Spark Red™ 718 anti-human CD56 (NCAM)
Human peripheral blood lymphocytes were stained with anti-hu... -
Cell-Vive™ GMP Ultra-LEAF™ Biotin anti-human CD56 (NCAM) SF
Human peripheral leukocytes were stained with Cell-Vive™ GMP...
Follow Us