- Clone
- M80 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Thrombomodulin, TM, THRM, THBD, Fetomodulin, BDCA-3
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GGATAACCGCGCTTT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
344131 | 10 µg | 369 CHF |
CD141 is a 75 kD, single chain, type I membrane glycoprotein also known as thrombomodulin, TM, THRM, THBD, and fetomodulin. CD141 is an important cofactor in the protein C anticoagulant system. After binding to its ligand thrombin, CD141 activates protein C, which degrades clotting factors Va and VIIIa, and as a consequence the amount of thrombin is reduced. CD141 is expressed on macrophages, monocytes, a subpopulation of myeloid dendritic cells, vascular endothelial cells, and keratinocytes. Besides anti-coagulation function, CD141 is also involved in embryonic and atherosclerotic plaque development.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2892418 (BioLegend Cat. No. 344131)
Antigen Details
- Structure
- Single chain, type I membrane glycoprotein, 75 kD
- Distribution
-
Macrophages, monocytes, subset of myeloid dendritic cells, vascular endothelial cells, keratinocytes
- Function
- After thrombin binding, CD141 activates protein C, which degrades clotting factors Va and VIIIa and reduces the amount of thrombin generated.
- Interaction
- Protein C, Thrombin-activatable fibrinolysis inhibitor (TAFI), Platelet factor 4 (PF4)
- Ligand/Receptor
- Thrombin
- Cell Type
- Dendritic cells, Endothelial cells, Macrophages, Monocytes
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules
- Antigen References
-
1. Suzuki K, et al. 1987. EMBO J. 6:1891.
2. Esmon CT, et al. 1989. J. Biol. Chem. 264:4743.
3. Delvaeye M, et al. 2009. N. Engl. J. Med. 361:345.
4. Shi CS, et al. 2008. Blood 112:3661.
5. Chen LC, et al. 2009. J. Infect. 58:368. - Gene ID
- 7056 View all products for this Gene ID
- UniProt
- View information about CD141 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD141 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD141 (Thrombomodulin)
Human peripheral blood monocytes stained with M80 PE LPS-stimulated (overnight) human peripheral blood mononuclea... -
PE anti-human CD141 (Thrombomodulin)
Human peripheral blood monocytes stained with M80 PE LPS-stimulated (overnight) human peripheral blood mononuclea... -
APC anti-human CD141 (Thrombomodulin)
Human peripheral blood monocytes were stimulated with LPS (o... -
Biotin anti-human CD141 (Thrombomodulin)
Human peripheral blood monocytes were stained with biotinyla... -
PE/Cyanine7 anti-human CD141 (Thrombomodulin)
LPS-stimulated (overnight) human peripheral blood monocytes ... -
PerCP/Cyanine5.5 anti-human CD141 (Thrombomodulin)
LPS-stimulated (overnight) human peripheral blood monocytes ... -
Brilliant Violet 421™ anti-human CD141 (Thrombomodulin)
LPS-stimulated (overnight) human peripheral blood monocytes ... -
Brilliant Violet 785™ anti-human CD141 (Thrombomodulin)
LPS-stimulated (overnight) human peripheral blood monocytes ... -
Brilliant Violet 605™ anti-human CD141 (Thrombomodulin)
LPS-stimulated (overnight) human peripheral blood monocytes ... -
PE/Dazzle™ 594 anti-human CD141 (Thrombomodulin)
Human peripheral blood monocytes were stimulated with LPS (o... -
TotalSeq™-A0163 anti-human CD141 (Thrombomodulin)
-
Alexa Fluor® 647 anti-human CD141 (Thrombomodulin)
Human peripheral blood monocytes were stained with CD141 (Th... -
TotalSeq™-C0163 anti-human CD141 (Thrombomodulin)
-
TotalSeq™-B0163 anti-human CD141 (Thrombomodulin)
-
KIRAVIA Blue 520™ anti-human CD141 (Thrombomodulin)
Human peripheral blood monocytes were stained with anti-huma... -
TotalSeq™-D0163 anti-human CD141 (Thrombomodulin)
-
PE/Fire™ 810 anti-human CD141 (Thrombomodulin)
Human peripheral blood monocytes were stained with anti-huma... -
Brilliant Violet 711™ anti-human CD141 (Thrombomodulin)
Human peripheral blood monocytes were stained with anti-huma...
Follow Us