- Clone
- A1 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- gp80, E-ATPDase, NTPDase-1, ecto-apyrase, Ec3.6.1.5
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TTACCTGGTATCCGT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
328243 | 10 µg | 369 CHF |
Human CD39 is an integral membrane protein with two transmembrane domains. It exists as a homotetramer. Expression of CD39 is found on activated lymphocytes, a subset of T cells and B cells, and dendritic cells with weak staining on monocytes and granulocytes. CD39 and CD73 have been found on regulatory T cells, specifically the effector/memory like T cells. CD39 can hydrolyze both nucleoside triphosphates and diphosphates. CD39 is the dominant ecto nucleotidase of vascular and placental trophoblastic tissues and appears to modulate the functional expression of type 2 purinergic (P2) G protein coupled receptors (GPCRs). CD39 has intrinsic ecto-ATPase activity. Expression of CD39 is induced on T cells and increased on B cells as a late activation antigen.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- PHA activated human lymphocytes
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The A1 antibody binds to the human CD39 cell surface antigen and has been shown to block MHC independent target cell recognition by hapten-specific CTL. Additional reported applications (for the relevant formats) include: in vitro CD39 blockade3, immunofluorescence4, immunohistochemistry6, and spatial biology (IBEX)7,8. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for blocking assays (contact our custom solutions team).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Aversa GG, et al. 1988. Transplant. P. 20:4952.
- Aversa GG, et al. 1989. Transplant. P. 21:34950.
- Borsellino G, et al. 2007. Blood. 110:1225. (Block)
- Stockl J, et al. 2001. J. Immunol. 167:2724. (IF)
- Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
- Lyck L, et al. 2008. J. Histochem. Cytochem. 56:201. (IHC)
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2892394 (BioLegend Cat. No. 328243)
Antigen Details
- Distribution
-
Activated lymphocytes, and also on a subset of T cells, regulatory T cells, B cells, and dendritic cells.
- Cell Type
- B cells, Dendritic cells, Lymphocytes, T cells, Tregs
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Gene ID
- 953 View all products for this Gene ID
- UniProt
- View information about CD39 on UniProt.org
Related FAQs
Other Formats
View All CD39 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Brilliant Violet 510™ anti-human CD39
Human peripheral blood lymphocytes were stained with CD39 (c... -
Brilliant Violet 421™ anti-human CD39
Human peripheral blood lymphocytes were stained with CD19 PE... Human paraffin-embedded placenta tissue slice was prepared w... -
Purified anti-human CD39
Human peripheral blood lymphocytes stained with purified A1,... -
Biotin anti-human CD39
Human peripheral blood lymphocytes stained with biotinylated... -
FITC anti-human CD39
Human peripheral blood lymphocytes stained with A1 FITC -
PE anti-human CD39
Human peripheral blood lymphocytes were stained with CD19 AP... Confocal image of human lymph node sample acquired using the... -
APC anti-human CD39
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Cyanine7 anti-human CD39
Human peripheral blood lymphocytes stained with A1 PE/Cyanin... Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Cyanine5.5 anti-human CD39
Human peripheral blood lymphocytes were stained with CD39 (c... -
Purified anti-human CD39 (Maxpar® Ready)
Human PBMCs stained with 147Sm-anti-CD20 (2H7) and 160Gd-ant... Human paraffin-embedded placenta tissue slice was stained wi... -
PE/Dazzle™ 594 anti-human CD39
Human peripheral blood lymphocytes were stained with CD39 (c... -
APC/Cyanine7 anti-human CD39
Human peripheral blood lymphocytes were stained with CD19 FI... -
Brilliant Violet 711™ anti-human CD39
Human peripheral blood lymphocytes were stained with CD19 PE... -
APC/Fire™ 750 anti-human CD39
Human peripheral blood lymphocytes were stained with CD19 FI... -
Alexa Fluor® 594 anti-human CD39
Human paraffin-embedded placenta tissue slice was prepared w... -
TotalSeq™-A0176 anti-human CD39
-
Brilliant Violet 605™ anti-human CD39
Human peripheral blood lymphocytes were stained with CD19 Al... -
TotalSeq™-C0176 anti-human CD39
-
Brilliant Violet 785™ anti-human CD39
Human peripheral blood lymphocytes were stained with CD19 Pa... -
TotalSeq™-B0176 anti-human CD39
-
TotalSeq™-D0176 anti-human CD39
-
PE/Fire™ 810 anti-human CD39 Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Cyanine5 anti-human CD39
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 806 anti-human CD39
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark NIR™ 685 anti-human CD39
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Red™ 718 anti-human CD39 (Flexi-Fluor™)
-
PE/Fire™ 744 anti-human CD39
Human peripheral blood lymphocytes were stained with anti-hu...
Follow Us