- Clone
- 9-4D2-1E4 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V MA199
- Other Names
- M-CSFR,CSF-1R, FMS, CSF-1 Receptor
- Isotype
- Rat IgG1, κ
- Barcode Sequence
- AATCACGGTCCTTGT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
347331 | 10 µg | 369 CHF |
CSF-1R, also known as CD115 and M-CSFR, is a single-pass type I membrane protein and member of the platelet-derived growth factor receptor family. Structural studies of CD115 have described an Ig-like extracellular domain, a transmembrane domain, an intracellular juxtamembrane domain, a split tyrosine kinase domain, and a C-terminal tail receptor. Receptor activation induces homodimerization in addition to phosphorylation and ubiquitinylation of intracellular residues. The natural ligands of CD115 include M-CSF and IL-34. CD115 directly influences tissue macrophage and osteoclast differentiation and proliferation. It is expressed on monocytes/macrophages, plasmacytoid and conventional dendritic cells, and osteoclasts.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- C-fms transduced Kirsten strain murine sarcoma virus transformed NRK cells.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
It has been reported that CD115 can be rapidly internalized, especially when samples are exposed to room temperature. Approximate 33% decrease in CD115 expression has been observed between 0 and 4 hours after sample collection, while overnight incubation of the cells results in complete CD115 downregulation. Pre-treatment with EDTA and low temperatures (2 to 8°C) helps in maintaining surface expression of CD1151.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Breslin WL, et al. 2013. J Immunol Methods. 390(1-2):1 PubMed
- RRID
-
AB_2922564 (BioLegend Cat. No. 347331)
Antigen Details
- Structure
- Single-pass type I membrane protein and is 150 kD.
- Distribution
-
Monocytes/macrophages, plasmacytoid and conventional dendritic cells, and osteoclasts.
- Ligand/Receptor
- Macrophage Colony Stimulating Factor (M-CSF) and IL-34.
- Cell Type
- Dendritic cells, Macrophages, Monocytes, Osteoclasts
- Biology Area
- Immunology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Sherr CJ, et al. 1989. Blood 73:1786
2. Roussel MF, et al. 1991. Nature 353:361.
3. Roussel MF, et al. 1989 P. Natl. Acad. Sci. USA 86:7924. - Gene ID
- 1436 View all products for this Gene ID
- UniProt
- View information about CD115 on UniProt.org
Related FAQs
- Why do I have a weak CD115 staining?
-
It has been reported that CD115 can be rapidly internalized, especially when samples are exposed to room temperature. Approximate 33% decrease in CD115 expression has been observed between 0 and 4 hours after sample collection, while overnight incubation of the cells results in complete CD115 downregulation. Pre-treatment with EDTA and low temperatures (2 - 8°C) helps in maintaining surface expression of CD115. In addition, brief fixation of the cells with Fixation Buffer (Cat. No. 420801) for 10 minutes will block CD115 internalization.
Other Formats
View All CD115 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC,IP |
PE anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC |
APC anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC |
PE/Cyanine7 anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC |
PerCP/Cyanine5.5 anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC |
Alexa Fluor® 488 anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC |
Biotin anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC |
Alexa Fluor® 647 anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC |
Brilliant Violet 711™ anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC |
PE/Dazzle™ 594 anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC |
Brilliant Violet 421™ anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC |
APC/Fire™ 750 anti-human CD115 (CSF-1R) | 9-4D2-1E4 | FC |
TotalSeq™-A0398 anti-human CD115 (CSF-1R) | 9-4D2-1E4 | PG |
TotalSeq™-C0398 anti-human CD115 (CSF-1R) | 9-4D2-1E4 | PG |
TotalSeq™-B0398 anti-human CD115 (CSF-1R) | 9-4D2-1E4 | PG |
TotalSeq™-D0398 anti-human CD115 (CSF-1R) | 9-4D2-1E4 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with purified ... -
PE anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with CD115 (cl... -
APC anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with CD115 (cl... -
PE/Cyanine7 anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with CD115 (cl... -
PerCP/Cyanine5.5 anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with CD115 (cl... -
Alexa Fluor® 488 anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with CD115 (cl... -
Biotin anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with biotinyla... -
Alexa Fluor® 647 anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with CD115 (cl... -
Brilliant Violet 711™ anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with anti-huma... -
PE/Dazzle™ 594 anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with anti-huma... -
Brilliant Violet 421™ anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with anti-huma... -
APC/Fire™ 750 anti-human CD115 (CSF-1R)
Human peripheral blood monocytes were stained with CD115 (CS... -
TotalSeq™-A0398 anti-human CD115 (CSF-1R)
-
TotalSeq™-C0398 anti-human CD115 (CSF-1R)
-
TotalSeq™-B0398 anti-human CD115 (CSF-1R)
-
TotalSeq™-D0398 anti-human CD115 (CSF-1R)
Follow Us