- Clone
- MHL-38 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Immunoglobulin light chain lambda
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- CAGCCAGTAAGTCAC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
316637 | 10 µg | 369 CHF |
The MHL-38 antibody reacts with both soluble and membrane human immunoglobulin light chain lambda (λ). It does not react with human immunoglobulin light chain kappa (κ) or heavy chains. The MHL-38 antibody can be used as primary or secondary reagent for immunofluorescent staining or ELISA analysis.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human Ig cocktail
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone MHL-38 is not compatible with Human TruStain FcX (Fc Receptor Blocking Solution) (Cat. No. 422301 & 422302).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2922550 (BioLegend Cat. No. 316637)
Antigen Details
- Structure
- Ig family
- Distribution
-
B cells
- Cell Type
- B cells
- Biology Area
- Immunology
- Gene ID
- 3535 View all products for this Gene ID
- UniProt
- View information about Ig light chain lambda on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All Ig light chain λ Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human Ig light chain λ
Over night cultured human peripheral blood lymphocytes stain... IHC staining using purified anti-human Ig light chain λ anti... -
Biotin anti-human Ig light chain λ
-
FITC anti-human Ig light chain λ
Human peripheral blood lymphocytes stained with MHL-38 FITC Human peripheral blood lymphocytes stained with MHL-38 FITC -
PE anti-human Ig light chain λ
Human peripheral blood lymphocytes stained with MHL-38 PE -
APC anti-human Ig light chain λ
Human peripheral blood lymphocytes stained with CD19 PE and ... -
Alexa Fluor® 488 anti-human Ig light chain λ
Human peripheral blood lymphocytes stained with MHL-38 Alexa... -
Alexa Fluor® 647 anti-human Ig light chain λ
Human peripheral blood lymphoctes stained with MHL-38 Alexa ... -
Pacific Blue™ anti-human Ig light chain λ
Human peripheral blood lymphocytes stained with CD19 PE and ... -
PerCP/Cyanine5.5 anti-human Ig light chain λ
Human peripheral blood lymphocytes were stained with CD19 PE... -
Purified anti-human Ig light chain λ (Maxpar® Ready)
Human PBMCs stained with 142Nd-anti-CD19 (HIB19) and 151Eu-a... -
PE/Dazzle™ 594 anti-human Ig light chain λ
Human peripheral blood lymphocytes stained with CD19 Brillia... -
PE/Cyanine7 anti-human Ig light chain λ
Human peripheral blood lymphocytes stained with CD19 Brillia... -
APC/Fire™ 750 anti-human Ig light chain λ
Human peripheral blood lymphocytes stained with CD19 Brillia... -
TotalSeq™-A0898 anti-human Ig light chain λ
-
TotalSeq™-C0898 anti-human Ig light chain λ
-
Alexa Fluor® 700 anti-human Ig light chain λ
Human peripheral blood lymphocytes were costained with CD19 ... -
TotalSeq™-B0898 anti-human Ig light chain λ
-
APC/Cyanine7 anti-human Ig light chain λ
Human peripheral blood lymphocytes were stained with CD19 FI... -
TotalSeq™-D0898 anti-human Ig light chain λ
-
TotalSeq™-Bn0898 anti-human Ig light chain λ
-
Spark Red™ 718 anti-human Ig light chain λ (Flexi-Fluor™)
-
PE anti-human Ig light chain λ
Typical results from overnight cultured human peripheral blo... -
APC anti-human Ig light chain λ
Typical results from overnight cultured human peripheral blo...
Follow Us