TotalSeq™-D0034 anti-human CD3 Antibody

Pricing & Availability
Clone
UCHT1 (See other available formats)
Regulatory Status
RUO
Workshop
III 471
Other Names
T3, CD3ε
Isotype
Mouse IgG1, κ
Barcode Sequence
CTCATTGTAACTCCT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
300485 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD3ε is a 20 kD chain of the CD3/T-cell receptor (TCR) complex which is composed of two CD3ε, one CD3γ, one CD3δ, one CD3ζ (CD247), and a T-cell receptor (α/β or γ/δ) heterodimer. It is found on all mature T cells, NKT cells, and some thymocytes. CD3, also known as T3, is a member of the immunoglobulin superfamily that plays a role in antigen recognition, signal transduction, and T cell activation.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections4,6,7 and formalin-fixed paraffin-embedded sections11, immunoprecipitation1, activation of T cells2,3,5, Western blotting9, and spatial biology (IBEX)16,17. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 300413, 300414, and 300432). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 300437, 300438, 300465, 300466, 300473, 300474) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin < 0.01 EU/µg).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Salmeron A, et al. 1991. J. Immunol. 147:3047. (IP)
  2. Graves J, et al. 1991. J. Immunol. 146:2102. (Activ)
  3. Lafont V, et al. 2000. J. Biol. Chem. 275:19282. (Activ)
  4. Ryschich E, et al. 2003. Tissue Antigens 62:48. (IHC)
  5. Thompson AG, et al. 2004. J. Immunol. 173:1671. (Activ)
  6. Sakkas LI, et al. 1998. Clin. Diagn. Lab. Immun. 5:430. (IHC)
  7. Mack CL, et al. 2004. Pediatr. Res. 56:79. (IHC)
  8. Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed
  9. Van Dongen JJM, et al. 1988. Blood 71:603. (WB)
  10. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  11. Pollard, K. et al. 1987. J. Histochem. Cytochem. 35:1329. (IHC)
  12. Luckashenak N, et al. 2013. J. Immunol. 190:27. PubMed
  13. Laurent AJ, et al. 2014. PLoS One. 9:103683. PubMed
  14. Li J, et al. 2015. Cancer Res. 75:508. PubMed
  15. Stoeckius M, et al. 2017. Nat. Methods. 14:865-868. (PG)
  16. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  17. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2892342 (BioLegend Cat. No. 300485)

Antigen Details

Structure
Ig superfamily, with the subunits of CD3γ, CD3δ, CD3ζ (CD247) and TCR (α/β or γ/δ) forms CD3/TCR complex, 20 kD
Distribution

Mature T and NK T cells, thymocyte differentiation

Function
Antigen recognition, signal transduction, T cell activation
Ligand/Receptor
Peptide antigen bound to MHC
Cell Type
NKT cells, T cells, Thymocytes, Tregs
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, TCRs
Antigen References

1. Barclay N, et al. 1993. The Leucocyte FactsBook. Academic Press. San Diego.
2. Beverly P, et al. 1981. Eur. J. Immunol. 11:329.
3. Lanier L, et al. 1986. J. Immunol. 137:2501-2507.

Gene ID
916 View all products for this Gene ID
UniProt
View information about CD3 on UniProt.org

Other Formats

View All CD3 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD3 UCHT1 FC
Biotin anti-human CD3 UCHT1 FC
FITC anti-human CD3 UCHT1 FC
PE anti-human CD3 UCHT1 FC
PE/Cyanine5 anti-human CD3 UCHT1 FC
Purified anti-human CD3 UCHT1 FC,CyTOF®,IHC-F,IP,Activ,WB
Alexa Fluor® 647 anti-human CD3 UCHT1 FC,ICC,IHC-F
Alexa Fluor® 488 anti-human CD3 UCHT1 FC,ICC,IHC-F
Pacific Blue™ anti-human CD3 UCHT1 FC
PE/Cyanine7 anti-human CD3 UCHT1 FC
Alexa Fluor® 700 anti-human CD3 UCHT1 FC
APC/Cyanine7 anti-human CD3 UCHT1 FC
PerCP anti-human CD3 UCHT1 FC
PerCP/Cyanine5.5 anti-human CD3 UCHT1 FC
Brilliant Violet 421™ anti-human CD3 UCHT1 FC,ICC,IHC-F
Brilliant Violet 570™ anti-human CD3 UCHT1 FC
Ultra-LEAF™ Purified anti-human CD3 UCHT1 FC,CyTOF®,IHC-F,IP,Activ,WB
Purified anti-human CD3 (Maxpar® Ready) UCHT1 FC,CyTOF®
Alexa Fluor® 594 anti-human CD3 UCHT1 ICC,FC,SB
PE/Dazzle™ 594 anti-human CD3 UCHT1 FC
Brilliant Violet 510™ anti-human CD3 UCHT1 FC
Brilliant Violet 605™ anti-human CD3 UCHT1 FC
Brilliant Violet 711™ anti-human CD3 UCHT1 FC
Brilliant Violet 650™ anti-human CD3 UCHT1 FC
APC/Fire™ 750 anti-human CD3 UCHT1 FC
Pacific Blue™ anti-human CD3 UCHT1 FC
Brilliant Violet 785™ anti-human CD3 UCHT1 FC
PE/Dazzle™ 594 anti-human CD3 UCHT1 FC
TotalSeq™-A0034 anti-human CD3 UCHT1 PG
TotalSeq™-B0034 anti-human CD3 UCHT1 PG
TotalSeq™-C0034 anti-human CD3 UCHT1 PG
PE anti-human CD3 UCHT1 FC
PE/Cyanine7 anti-human CD3 UCHT1 FC
KIRAVIA Blue 520™ anti-human CD3 UCHT1 FC
Spark Violet™ 538 anti-human CD3 Antibody UCHT1 FC
TotalSeq™-D0034 anti-human CD3 UCHT1 PG
Spark Blue™ 574 anti-human CD3 Antibody UCHT1 FC
GMP Pacific Blue™ anti-human CD3 UCHT1 FC
GMP PE anti-human CD3 UCHT1 FC
GMP PE/Dazzle™ 594 anti-human CD3 UCHT1 FC
Spark Violet™ 423 anti-human CD3 UCHT1 FC
GMP PE/Cyanine7 anti-human CD3 UCHT1 FC
Spark Blue™ 515 anti-human CD3 UCHT1 FC
Go To Top Version: 1    Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account