- Clone
- HI10a (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V CD10.7
- Other Names
- Common acute lymphoblastic leukemia antigen (CALLA), Enkephalinase, Neutral endopeptidase, Neprilysin
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CAGCCATTCATTAGG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
312239 | 10 µg | 296€ |
CD10 is a 100 kD neutral endopeptidase and a member of the metalloprotease family. It is a type II transmembrane protein also known as common acute lymphoblastic leukemia antigen (CALLA), enkephalinase, and neprilysin. CD10 is expressed on B cell precursors, T cell precursors, and neutrophils. CD10 is involved in B cell development and has been shown to bind opioid enkephalins, bradykinin, angiotensins I and II, and other biologically active peptides.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- African Green, Baboon, Capuchin monkey, Chimpanzee
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2892378 (BioLegend Cat. No. 312239)
Antigen Details
- Structure
- Type II transmembrane metalloprotease family, 100 kD
- Distribution
-
B cell precursors, T cell precursors, neutrophils
- Function
- Zinc-binding metalloproteinase, B cell development
- Ligand/Receptor
- Biologically active peptides including opioid enkephalins, bradykinin, angiotensions I & II
- Cell Type
- B cells, Neutrophils
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Shipp M, et al. 1993. Blood 82:1052.
2. Lu B, et al. 1995. J. Exp. Med. 181:2271. - Gene ID
- 4311 View all products for this Gene ID
- UniProt
- View information about CD10 on UniProt.org
Related FAQs
Other Formats
View All CD10 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD10
Nalm-6 cell line stained with purified HI10a and detected wi... -
PE anti-human CD10
Human peripheral blood granulocytes were stained with CD10 (... -
PE/Cyanine5 anti-human CD10
Human pre- B cell line REH stained with HI10a PE/Cyanine5 -
FITC anti-human CD10
Human pre-B cell line REH stained with HI10a FITC -
APC anti-human CD10
Nalm-6 cell line stained with purified HI10a and detected wi... -
APC/Cyanine7 anti-human CD10
Human peripheral blood granulocytes were stained with CD10 (... -
PE/Cyanine7 anti-human CD10
Human peripheral blood granulocytes stained with HI10a PE/Cy... -
PerCP/Cyanine5.5 anti-human CD10
Human peripheral blood granulocytes were stained with CD10 (... -
Brilliant Violet 421™ anti-human CD10
Human pre-B cell line REH was stained with CD10 (clone HI10a... -
Brilliant Violet 510™ anti-human CD10
Human peripheral blood granulocytes were stained with CD10 (... -
Brilliant Violet 605™ anti-human CD10
Human peripheral blood granulocytes were stained with anti-h... -
Purified anti-human CD10 (Maxpar® Ready)
Human PBMCs (top) and human NALM-6 pre-B cells (bottom) stai... -
Brilliant Violet 711™ anti-human CD10
Human peripheral blood granulocytes were stained with CD10 (... -
PE/Dazzle™ 594 anti-human CD10
Human peripheral blood granulocytes were stained with CD10 (... -
APC/Fire™ 750 anti-human CD10
Human peripheral blood granulocytes were stained with anti-h... -
APC anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
PE anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
FITC anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
TotalSeq™-A0062 anti-human CD10
-
TotalSeq™-C0062 anti-human CD10
-
APC/Fire™ 750 anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
TotalSeq™-B0062 anti-human CD10
-
PE/Cyanine7 anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
PerCP/Cyanine5.5 anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
Brilliant Violet 785™ anti-human CD10
Human peripheral blood granulocytes was stained with anti-hu... -
TotalSeq™-D0062 anti-human CD10
-
GMP APC anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
GMP FITC anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
GMP PE/Cyanine7 anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
GMP PE anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
PE/Dazzle™ 594 anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
GMP PerCP/Cyanine5.5 anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
Brilliant Violet 650™ anti-human CD10
Human peripheral blood granulocytes were stained with anti-h... Human peripheral blood lymphocytes, monocytes, and granulocy... -
GMP PE/Dazzle™ 594 anti-human CD10
Typical results from human peripheral blood granulocytes sta... -
Brilliant Violet 750™ anti-human CD10
Human peripheral blood granulocytes were stained anti-human ... Human peripheral blood cells were stained with anti-human CD... -
Spark Violet™ 423 anti-human CD10
Human peripheral blood granulocytes were stained with anti-h... -
Spark YG™ 593 anti-human CD10
Human peripheral blood granulocytes were stained with anti-h... Human peripheral blood granulocytes were stained with anti-h... -
Spark Blue™ 574 anti-human CD10
Human peripheral blood granulocytes were stained with anti-h... -
PE/Fire™ 640 anti-human CD10
Human peripheral blood granulocytes were stained with anti-h...
Follow Us