- Clone
- AER-37 (CRA-1) (See other available formats)
- Regulatory Status
- RUO
- Other Names
- FceRIa, FceRI-a, FceRI-alpha, FceRI alpha, high affinity IgE receptor
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- CTCGTTTCCGTATCG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
High affinity IgE receptor (FcεRI) plays a key role in IgE-mediated allergic immune response. FcεRI is a tetrameric receptor complex, which is composed of one α-subunit (FcεRIα), one β-subunit, and two γ-subunits. FcεRIα directly binds IgE with high affinity, while the β- and γ-chains are responsible for mediating intracellular signals. FcεRIα is a 50 kD transmembrane protein with Ig superfamily structure. It is primarily found on mast cells and basophils. Further studies have indicated that FcεRIα is also expressed on many inflammatory cells including cutaneuos Langerhans cells, dendritic cells, monocytes of patients with allergic disorders, platelets, bronchial epithelial cells, eosinophils produced in hypereosinophilic syndrome, and neutrophils from allergy-induced asthma patients.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone AER-37 (CRA-1) has been reported to bind the receptor even in the presence of IgE.4
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Yamaguchi M, et al. 1999. J. Immunol. 162:5455.
- Suzukawa M, et al. 2005. Int. Immunol. 17:1249.
- Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
- Yamaguchi M, et al. 1999. J. Immunol. 162:5455.
- RRID
-
AB_2892406 (BioLegend Cat. No. 334651)
Antigen Details
- Structure
- Ig superfamily, 50 kD
- Distribution
-
Mast cells, basophils, cutaneuos Langerhans cells, dendritic cells, and monocytes from the patients with allergic disorders, platelets, bronchial epithelial cells, eosinophils from hypereosinophilic syndrome, neutrophils from allergic asthmatic patients
- Function
- Bind IgE, trigger IgE-mediated allergic response
- Ligand/Receptor
- IgE
- Cell Type
- Basophils, Dendritic cells, Eosinophils, Langerhans cells, Mast cells, Monocytes, Neutrophils
- Biology Area
- Immunology
- Molecular Family
- Fc Receptors
- Antigen References
-
1. Riske F, et al. 1991. J. Biol. Chem. 266:11245
2. Gounni AS, et al. 2001. FASEB J. 15:940.
3. Maurer D, et al. 1996. J. Immunol. 157:607
4. Maurer d, et al. 1994. J. Exp. Med. 179:745
5. Campbell AM, et al. 1998. Am. J. Respir. Cell Mol. Biol. 19:92. - Gene ID
- 2205 View all products for this Gene ID
- UniProt
- View information about FcepsilonRIalpha on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All FcεRIα Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human FcεRIα
Human peripheral blood lymphocytes stained with purified AER... -
Biotin anti-human FcεRIα
Human peripheral blood lymphocytes were stained with CD203c ... -
FITC anti-human FcεRIα
Human peripheral blood leukocytes stained with CD203c (NP4D6... -
PE anti-human FcεRIα
Human peripheral blood leukocytes stained with AER-37 (CRA-1... -
Alexa Fluor® 647 anti-human FcεRIα
Human peripheral blood leukocytes stained with CD203c (NP4D6... -
PerCP anti-human FcεRIα
Human peripheral blood leukocytes stained with CD203c (NP4D6... -
APC anti-human FcεRIα
Human peripheral blood lymphocytes stained with CD203c (NP4D... -
Pacific Blue™ anti-human FcεRIα
Human peripheral leukocytes stained with CD203c (NP4D6) PE a... -
PE/Cyanine7 anti-human FcεRIα
Human peripheral blood leukocytes stained with CD203c (NP4D6... -
PerCP/Cyanine5.5 anti-human FcεRIα
Human peripheral blood lymphocytes were stained with CD203c ... -
Brilliant Violet 421™ anti-human FcεRIα
Human peripheral blood lymphocytes were stained with CD203c ... -
Brilliant Violet 510™ anti-human FcεRIα
Human peripheral blood lymphocytes were stained with CD203c ... -
Brilliant Violet 605™ anti-human FcεRIα
Human peripheral blood lymphocytes were stained with CD203c ... -
APC/Cyanine7 anti-human FcεRIα
Human peripheral blood lymphocytes were stained with CD203c ... -
Alexa Fluor® 700 anti-human FcεRIα
Human peripheral blood lymphocytes were stained with CD203c ... -
PE/Dazzle™ 594 anti-human FcεRIα
Human peripheral blood lymphocytes were stained with CD203c ... -
Brilliant Violet 711™ anti-human FcεRIα
Human peripheral blood lymphocytes were stained with CD203c ... -
Alexa Fluor® 488 anti-human FcεRIα
Human peripheral blood lymphocytes were stained with CD203c ... -
TotalSeq™-A0352 anti-human FcεRIα
-
TotalSeq™-C0352 anti-human FcεRIα
-
APC/Fire™ 750 anti-human FcεRIα
Human peripheral blood lymphocytes were stained with CD203c ... -
Ultra-LEAF™ Purified anti-human FcεRIα
Human peripheral blood lymphocytes stained with purified AER... -
TotalSeq™-B0352 anti-human FcεRIα
-
TotalSeq™-D0352 anti-human FcεRIα
Follow Us