TotalSeq™-D0819 anti-human CD126 (IL-6Rα) Antibody

Pricing & Availability
Clone
UV4 (See other available formats)
Regulatory Status
RUO
Other Names
IL-6R1, gp80, IL-6 receptor alpha, IL-6R
Isotype
Mouse IgG1, κ
Barcode Sequence
TGATGGGAGCTTATC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Save
352819 10 µg ¥81,180
Description

CD126 is an 80 kD IL-6 receptor α chain also known as IL-6R. It is a member of the immunoglobulin superfamily that is expressed on plasma cells, T cells, activated B cells, monocytes, granulocytes, hepatocytes, epithelial cells, and fibroblasts. Functional IL-6 receptors are formed by the non-covalent association of CD126 and the IL-6 receptor β chain (CD130 or gp130). CD126 binds IL-6 with low affinity but does not signal. The β chain (gp130, CD130) does not bind IL-6 by itself but associates with the α-chain/IL-6 complex to initiate signal transduction. IL-6 binding to the receptor complex results in the stimulation of B and T cells, and hematopoietic precursor proliferation and differentiation. A soluble form of CD126 has been found in human serum.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human myeloma cell line U266
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

 


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: blocking of IL-6 binding to IL-6R.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Huang YW and Vitetta ES. 1993. Hybridoma 12:621.
RRID
AB_2894593 (BioLegend Cat. No. 352819)

Antigen Details

Structure
Ig superfamily, associates with IL-6Rβ chain (CD130, gp130), 80 kD
Distribution

Plasma cells, T cells, monocytes, hepatocytes, activated B cells, granulocytes, epithelial cells, and fibroblasts

Function
Stimulates T cells, B cells, and hematopoietic precursor proliferation and differentiation
Interaction
CD130, c-Src, STAT3, WWP1, WWP2
Ligand/Receptor
IL-6
Cell Type
B cells, Epithelial cells, Fibroblasts, Granulocytes, Monocytes, Plasma cells, T cells
Biology Area
Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience, Signal Transduction
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Taga T, et al. 1997. Annu. Rev. Immunol. 15:797.
2. Fitzgerald K, et al. 2001. The Cytokine FactsBook. Academic Press London.
3. Boulanger MJ, et al. 2003. Science 300:2101.
4. Gaillard JP, et al. 1993. Eur. J. Immunol. 23:820.

Gene ID
3570 View all products for this Gene ID
UniProt
View information about CD126 on UniProt.org
Go To Top Version: 1    Revision Date: 09/14/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account