- Clone
- VI-PL2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Integrin β3, gpIIIa
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AGGTTGGAGTAGACT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
336429 | 10 µg | 296€ |
CD61, also known as integrin β3 and glycoprotein IIIa (gpIIIa), is a 90 kD type I integral transmembrane glycoprotein. It is a member of the integrin family, associating with platelet gpIIb (CD41) to form CD41/CD61 complex and with integrin αV (CD51) to form αV/β3 (CD51/CD61) integrin. CD41/CD61 is expressed on platelets and megakaryocytes, and plays a role in platelet activation and aggregation through interaction with fibrinogen, fibronectin, vWF, and other RGD-containing adhesion molecules. CD51/CD61 is expressed on platelets, osteoclasts, fibroblasts, macrophages, and some tumor cells involved in tumor metastasis, and in adenovirus infection through binding to RGD motif in extracellular matrix proteins.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- African Green, Baboon
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: Western blotting and immunohistochemical staining of frozen tissue sections.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Davies J, et al. 1989. J. Cell Biol. 109:1817.
- Roberts M, et al. 2004. Mol. Cell. Biol. 24:1505.
- Ciarlet M, et al. 2002. J. Virol. 76:1109.
- RRID
-
AB_2922555 (BioLegend Cat. No. 336429)
Antigen Details
- Structure
- Type I integral glycoprotein, integrin family, associates with CD41 (gpIIb) forming CD41/CD61 complex or with CD51 (integrin αV) forming CD51/CD61 complex, 90 kD
- Distribution
-
CD41/CD61 complex is expressed on platelets and megakaryocytes; CD51/CD61 complex is expressed on platelets, osteoclasts, fibroblasts, macrophages, and some tumor cells
- Function
- Adhesion, platelet activation and aggregation
- Ligand/Receptor
- Fibronectin, vitronectin, vWF
- Cell Type
- Fibroblasts, Megakaryocytes, Osteoclasts, Platelets
- Biology Area
- Immunology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules: The CD Markers.
- Gene ID
- 3690 View all products for this Gene ID
- UniProt
- View information about CD61 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD61 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD61 | VI-PL2 | FC,CyTOF®,ICC,IHC-F,WB |
FITC anti-human CD61 | VI-PL2 | FC |
PE anti-human CD61 | VI-PL2 | FC |
Alexa Fluor® 647 anti-human CD61 | VI-PL2 | FC,ICC |
PerCP anti-human CD61 | VI-PL2 | FC |
APC anti-human CD61 | VI-PL2 | FC |
Purified anti-human CD61 (Maxpar® Ready) | VI-PL2 | FC,CyTOF® |
PE/Cyanine7 anti-human CD61 | VI-PL2 | FC |
PerCP/Cyanine5.5 anti-human CD61 | VI-PL2 | FC |
APC/Fire™ 750 anti-human CD61 | VI-PL2 | FC |
Alexa Fluor® 700 anti-human CD61 | VI-PL2 | FC |
TotalSeq™-A0372 anti-human CD61 | VI-PL2 | PG |
PE/Dazzle™ 594 anti-human CD61 | VI-PL2 | FC |
TotalSeq™-C0372 anti-human CD61 | VI-PL2 | PG |
TotalSeq™-D0372 anti-human CD61 | VI-PL2 | PG |
FITC anti-human CD61 | VI-PL2 | FC |
TotalSeq™-B0372 anti-human CD61 | VI-PL2 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD61
MDA-MB-231 breast cancer cells were stained with anti-CD61 (... Human peripheral blood platelets stained with purified VI-PL... -
FITC anti-human CD61
Human peripheral blood platelets stained with VI-PL2 FITC -
PE anti-human CD61
Human peripheral blood platelets stained with VI-PL2 PE -
Alexa Fluor® 647 anti-human CD61
Human peripheral blood platelets stained with VI-PL2 Alexa F... MDA-MB435 breast cancer cell line was stained with 20 µg/mL ... -
PerCP anti-human CD61
Human peripheral blood platelets were stained with CD61 (clo... -
APC anti-human CD61
Human peripheral blood platelets were stained with CD61 (clo... -
Purified anti-human CD61 (Maxpar® Ready)
Human PBMCs stained with 150Nd-anti-CD61 (VI-PL2). B lymphoc... -
PE/Cyanine7 anti-human CD61
Human peripheral blood platelets were stained with CD61 (clo... -
PerCP/Cyanine5.5 anti-human CD61
Human peripheral blood platelets were stained with CD61 (clo... -
APC/Fire™ 750 anti-human CD61
Human peripheral blood platelets were stained with CD61 (clo... -
Alexa Fluor® 700 anti-human CD61
Human peripheral blood platelets were stained with CD61 (clo... -
TotalSeq™-A0372 anti-human CD61
-
PE/Dazzle™ 594 anti-human CD61
Human peripheral blood platelets were stained with CD61 (clo... -
TotalSeq™-C0372 anti-human CD61
-
TotalSeq™-D0372 anti-human CD61
-
FITC anti-human CD61
Typical results from human peripheral blood platelets staine... -
TotalSeq™-B0372 anti-human CD61
Follow Us